![qiagen clc genomics workbench qiagen clc genomics workbench](https://www.qiagen.com/-/media/project/qiagen/qiagen-home/content-worlds/liquid-biopsy/when-exomes-talk.jpg)
BLAST searches of the resulting contigs revealed the presence of only one virus contig of 5,958 nt nearly identical (99.13%) to CVEV isolates from Zhejiang province, China (Huang et al. A total of 15,216,605 clean nonhost reads were assembled de novo by CLC Genomics Workbench 9.5 (Qiagen). A cDNA library was constructed using a TruSeq RNA Sample Prep kit (Illumina, San Diego, CA), and sequencing was conducted with an Illumina HiSeq X-ten platform (Mega Genomics, Beijing, China). To identify viral and virus-like pathogens in the symptomatic trees, total RNA was extracted from the leaf tissues of one symptomatic tree and subjected to ribosomal RNA depletion. reticulata) trees in Shimian county, Sichuan province, China. In 2016, symptoms of tree decline, fruit dysplasia, and superficial necrotic spots were observed on Huangguogan (Citrus sinensis × C. Citrus vein enation virus (CVEV), a member of the genus Enamovirus in the family Luteoviridae, is the causal agent of citrus vein enation disease (Vives et al. However, the yield and quality of citrus fruits are greatly affected by various diseases, including viral diseases. Moreover, CVEV can be transmitted by propagation and by several species of aphids, and thus the virus can be a serious threat to the cultivation of citrus in Sichuan province.Ĭitrus fruit production in Sichuan, the third citrus producing province in China, increased dramatically, from 4 million acres in 2014 to 6 million acres in 2017. To our knowledge, this is the first report of CVEV in Sichuan province, China, which expands our knowledge on its distribution and genetic variation. Results showed that 52 of 55 symptomatic samples and six of the 10 asymptomatic samples were virus infected, suggesting that CVEV is widespread in the region. To investigate the incidence of CVEV in the orchards, samples were collected from 65 Huangguogan trees with or without symptoms from four orchards in Shimian county and tested by RT-PCR. Six months after inoculation, small papillae were observed on leaf veins of the lower surface on the five Mexican lime trees, and the CVEV infection was confirmed by RT-PCR using virus-specific primers (JC-F1: GGAATGCCTTGCTACCAT JC-R1: GAGAGGTGAATAACGCACAG). aurantifolia) seedlings, and the grafted plants were maintained in a screenhouse. Buds collected from the diseased trees were graft inoculated onto Mexican lime (C.
![qiagen clc genomics workbench qiagen clc genomics workbench](https://www.cloudscientific.com/Public/Uploads/Product/CLC/7.png)
KY303624), was determined to be 5,983 nt, which shared the highest nucleotide sequence identity of 97.4% with that of a Korean isolate CVEV-PCJ. The complete genomic sequence of the Huangguogan-SM isolate of CVEV, designated as CVEV-SM (accession no.
![qiagen clc genomics workbench qiagen clc genomics workbench](https://renewtd.weebly.com/uploads/1/2/4/8/124867419/776074771.png)
Reverse transcription PCR (RT-PCR) and 5′/3′ rapid amplification of cDNA ends (RACE) assays were conducted using OneStep RT-PCR (Takara Bio) and RACE (ThermoFisher Scientific Corp.) kits, respectively. To obtain the whole genome sequence of the CVEV isolate, sequences of six known CVEV isolates (CVEV-PCJ: LC_433634 CVEV-STM-1: LC_089853 CVEV-YM1: LC_089850 CVEV-VE-1: HF_679486 CVEV-IBK: LC_089852, and CVEV-PTC: LC_433635) and the CVEV contig obtained in this study were aligned, and primers pairs were designed to generate overlapping amplicons. Citrus fruit production in Sichuan, the third citrus producing province in China, increased dramatically, from 4 million acres in 2014 to 6 million acres in 2017.